*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.
Author: | Zuzahn Fesho |
Country: | Yemen |
Language: | English (Spanish) |
Genre: | Marketing |
Published (Last): | 22 January 2016 |
Pages: | 248 |
PDF File Size: | 17.89 Mb |
ePub File Size: | 8.77 Mb |
ISBN: | 421-9-90250-292-1 |
Downloads: | 82359 |
Price: | Free* [*Free Regsitration Required] |
Uploader: | Goltidal |
Email alerts New issue alert. Gadda G, Francis K.
Re analyzing community-wide datasets without major infrastructure. ExplorEnz – The Enzyme Database: Draft genome of the lined seahorse, Hippocampus erectus Qiang Lin.
It furthers the University’s objective of excellence in research, scholarship, and education by publishing worldwide. Oxford University Press is a department of the University of Oxford.
Sponsors of Barbados Gospelfest 2018 “Touching Lives Changing Nations”
Involvement of a flavosemiquinone in the enzymatic oxidation of nitroalkanes catalyzed by 2-nitropropane dioxygenase. Biochim Biophys 528 R R R R R Xun L, Sandvik ER. C ]; nitrite [CPD: C ]; O2 [CPD: These generated genomic data are going to enrich bgu resource of this economically important fish, and also provide insights into the genetic mechanisms of its iconic morphology and male pregnancy behavior. Active towards linear alkyl nitronates of lengths between 2 and 6 carbon atoms and, with lower activity, towards propylnitronate.
J Biol Chem It has become very popular in China for its wide use in traditional Chinese medicine. C ]; O2 [CPD: Crystal structure of 2-nitropropane dioxygenase complexed with FMN and substrate. We report a draft genome of the lined seahorse. The enzyme uses FADH2 as a substrate rather than a cofactor [4].
Molecular characterization of 4-hydroxyphenylacetate 3-hydroxylase of Escherichia coli. Citing articles via Web of Science 2. Francis K, Gadda G. Functional analysis of the small component of the 4-hydroxyphenylacetate 3-monooxygenase of Escherichia coli W: Using homology-based, de novo and transcriptome-based prediction methods, we predicted 20 protein-coding genes in the generated assembly, which is less than our previously reported gene number 23 of the tiger tail seahorse H.
5182
Identification of the catalytic base. Characterization of an Escherichia coli aromatic hydroxylase with a broad substrate range.
Barbados Gospelfest / About / Contact
Bpet Bpet Bpet Bpet Here, we provide whole genome sequencing, assembly, and gene annotation of the lined seahorse, which can enrich genome resource and further application for its molecular breeding. Previously classified as 2-nitropropane dioxygenase EC 1.
Published by Oxford University Press. Close mobile search navigation Article navigation. J Biol Chem Appl Environ Microbiol Availability of supporting data. Characterization of the anthranilate degradation pathway in Geobacillus thermodenitrificans NG Related articles in Web of Science Google Scholar. The enzymes from the fungus Neurospora crassa and the yeast Williopsis saturnus var.